May 27, 2020 | Jerry Bergman

Darwin Myths Die Hard

 

Evolution Myths Hang on Long After They are Disproven
In some cases for over 150 years!

by Jerry Bergman, PhD

Evolution myths that support the Darwin story of our origins tend to be uncritically accepted and passed on long after they have been falsified. Here are several examples.

Vestigial Organs

One example is the alleged “nictitating membrane” in the human eye, claimed to be a vestigial structure from distant evolutionary ancestors. The term nictitating membrane, from Latin nictare (to blink), is a transparent third eyelid in some animals that can be moved across the eye for protection from dust and for moistening the eye while maintaining vision. The Darwinian belief regarding this structure was that it served as evidence of our reptilian ancestry.

In fact, it was documented in the 1920s that the nictitating membrane in humans was not a nictitating membrane, nor was it vestigial, but rather it was a plica semilunaris — a very different structure that is there for a very different purpose. The plica semilunaris is a small fold of conjunctiva tissue on the medial canthus of the eye that maintains tear drainage, and permits greater rotation of the eyeball.[1] Actually, without the plica, the conjunctiva would attach directly to the eyeball, thereby restricting its movement.[2] The false nictitating membrane idea was begun by none other than Charles Darwin in 1871. It is still listed today over a century and a half later as a leading example of a vestigial organ! [3] The authoritative Encyclopedia Britannica has it listed as vestigial organ number 4 in its list![4] The Britannica defines vestigial as “remnants of evolutionary history …. translated from the Latin vestigial.”

The 1 Percent Myth

Recently, Business Insider repeated another Darwin myth in bold letters, saying, “Our DNA is 99.9% the same as the person next to us — and we’re surprisingly similar to a lot of other living things.” The article begins with a photo of primate scientist Jane Goodall kissing a chimpanzee. It goes on to push Darwinism with a list of similarities, using animated illustrations and bold print:

  • The genetic similarity between a human and a human is 99.9%
  • The genetic similarity between a human and a chimpanzee is 96%
  • The genetic similarity between a human and a cat is 90%
  • The genetic similarity between a human and a mouse is 85%
  • The genetic similarity between a human and a cow is 80%
  • The genetic similarity between a human and a fruit fly is 61%
  • The genetic similarity between a human and a chicken is 60%
  • The genetic similarity between a human and a banana is 60%[5]

This is a blatant attempt to promote an assumed evolutionary progression from our closest to our most distant evolutionary relatives. On examination, is it not the absurd to conclude that we are as evolutionary distant from a chicken as from a banana? And yet, when one reads the fine print, the article admits problems such as the mice-to-humans 85%-similar comparison is for protein-encoding genes only. For non-protein coding genes, the number is only about 50%. This qualification was not noted, but should have been, for the human-to-chimp comparison which was highlighted. Readers seeing the bold headline and scanning the list will probably miss that important fact.

The 95-, even 99-percent chimp-human comparison has been repeated thousands of times, according to Google searches. It is found even in book titles, such as HUMAN AND CHIMPS: The 96 Percent Similarity of Humans and Chimps[6] which claims that “Researchers have sequenced the genome of the chimpanzee and found that people are 96 percent similar [to chimps], very interesting information everybody must have knowledge of.” Another title is “99% Ape: How Evolution Adds Up.[7] The title refers to the claim that humans are 99% ape. This erroneous idea was even accepted by some leading theistic evolutionists. For example, BioLogos theistic evolutionist Dennis Venema, a professor at the largest Christian University in Canada, wrote “our entire genomes are either around 95 per cent, or 98 per cent identical, depending on how one counts the effects of deletions of small blocks of DNA.”[8]

Likewise,  the 1% difference myth is endlessly repeated in leading science magazines. A Smithsonian Magazine article titled ‘SMARTNEWS Keeping you current’ reads, “What does it mean to be 99 percent Chimp?” Then, the article explains what it means, namely we humans are 99% chimp. Even in the most authoritative scientific journals the myth has been repeated ad nauseum. A Scientific American article concluded,  “Most studies indicate that when genomic regions are compared between chimpanzees and humans, they share about 98.5 percent sequence identity.”[9] Another example is Science which advertised that “since researchers sequenced the chimp genome in 2005, they have known that humans share about 99% of our DNA with chimpanzees, making them our closest living relatives.”[10] The last example, a report in Nature, claimed, “We share more than 98% of our DNA and almost all of our genes with our closest living relative, the chimpanzee.”[11]

The 1% Claim Shattered

This claim has long been shattered by research. An article in the American’s leading science magazine Science proclaimed “Relative Differences: The Myth of 1%.”[12] The article was not published this year, after the books and articles repeated the myth, but in 2007, thirteen years ago! The author explained the one percent claim was known to be problematic from the beginning of its life:

When King and the rest of the researchers in the Chimpanzee Sequencing and Analysis Consortium first detailed the genome of our closest relative in 2005, they simultaneously provided … the most dramatic evidence of its limitations. The consortium researchers aligned 2.4 billion bases from each species and came up with a 1.23% difference. However, as the chimpanzee consortium noted, the figure reflects only base substitutions, not the many stretches of DNA that have been inserted or deleted in the genomes. The chimp consortium [only] calculated … these “indels.”[13]

Further research revealed many more differences: “the December 2006 issue of PLoS ONE, Hahn and co-workers reported that human and chimpanzee gene copy numbers differ by a whopping 6.4%.”[14] Then it was systematically determined “by applying systems biology to quantifying and analyzing genetic differences between human and chimpanzee brains. … [Working with] UCLA biostatistician Steve Horvath, Geschwind compared which of 4000 genes were turned on at the same time, or “coexpressed,” in specific regions of the dissected brains. With these data, they built gene networks for each species.” They concluded that “A gene’s position in a network has huge implications [rendering the percent similarity very limited].” Genes that are coexpressed most frequently with other genes were found to have the most functional relevance.[15] Then it was revealed in a 2006 article that “Comparisons of the map of each cluster’s network in each species plainly showed that certain connections exist in humans but not chimps. In the cortex, for example, 17.4% of the connections were specific to humans.”[16]

We are now in the year 2020, so the similarity problem surely has been resolved. So what is the correct difference percent? We can do no better than quote the 2007 article which correctly asked:

Could researchers combine all of what’s known and come up with a precise percentage difference between humans and chimpanzees? “I don’t think there’s any way to calculate a number,” says geneticist Svante Pääbo, a chimp consortium member based at the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany. “In the end, it’s a political and social and cultural thing about how we see our differences.

This was well put and should have been listened to thirteen years ago. Svante Pääbo is correct:  “In the end, it’s a political and social and cultural thing about how we see our differences.” The one percent claim is not science, but a gross distortion of science for political purposes. As a result the article added “today we take as a given that the two species are genetically 99% the same.”  They added, “the 1% truism should be retired.” For the last thirteen years, Darwinists have ignored this sage advice.

The Latest Research

More detailed research has determined that the best genetic-comparison estimate is not 99, 95 or even 90 percent but 84 percent similarity. That 16 percent difference represents 3/4 of a billion base pair differences.[17] The length of the 23 human chromosomes is about six feet, and the only way this molecular length can be sequenced at present if to break up the strands into lengths that can be worked with, then reassemble the sections. In the early DNA-sequencing work scientists were able to sequence only very short DNA segments.

Thus, researchers focused on DNA segments that they knew would be highly similar between animals, such as blood globin proteins. Even in those genes there was a problem. The chimp genome is much longer than the human genome: there are 3,096,649,726 base pairs in the human genome and 3,309,577,922 base pairs in the chimpanzee genome – a 6.4% difference.[18]  Furthermore, humans have forty-six chromosomes, chimps forty-eight. It is difficult to compare gene sections that are not even slightly comparable, such as the following two sequences that show almost no congruence between the first and second line. Consider this example, where the five cases of congruence are in bold and underlined:

ATTTGGGGTCCTTTTCCCGTAGTAACCTTCCCAAATGTTTGGCATCGTACGCTG

AAGGGTTGGGGAATATAGGGCGCGCGTATAGCGCGTGTGTTCTCTCGTACTAA

Evolutionists tend to ignore these large sections lacking congruence in their quest to focus on similarities. Non-coding regions used to be called ‘junk DNA’ back in the days before they were recognized as important segments with critical regulatory functions.

Here’s another fallacy: one cannot glean meaningful comparisons between the common occurrence of DNA sequences existing only in humans, but not in chimps. Thus, the comparisons made are largely within the genic regions DNA, such as those that code for blood cell proteins like hemoglobin. One would expect they would have very similar genes because, for hemoglobin to function, the protein must be a very specific shape. Consequently, a good deal of sequence similarity exists between species that need the same functional similarity. But non-coding regions—which are just as important—show more variations, thus skewing the claimed similarities.

Some researchers are not above fraud. At least one lab that helped to assemble the chimp sequence admitted that they inserted human DNA sequences into the chimp genome, based on evolutionary assumptions, to fill in gene gaps for which no chimp sequence existed. Therefore, the published chimp genome is partly based on the human genome and, as a result, appears far more human than it actually is!

Another thing to beware of is that protein-coding genes can produce many different individual messenger RNA variants due to alternative splicing. For example, over a million protein varieties can be made from only 30,000 or fewer genes, which is close to the number of genes estimated to exist in humans. Many of these variants are produced through epigenetic mechanisms.

So in spite of their similarities, human genes and chimpanzee genes can produce major differences in proteins. The epigenetic differences between humans and chimps is likely far greater than gene differences. These few points illustrate the fact that a chasm exists between human and chimp genotypes, which helps to explain the chasm existing between humans and chimp phenotypes.

Summary

These two examples of Darwin myths – vestigial structures in the eye and the 1% similarity myth between humans and chimps – are among many blunders, frauds and forgeries I report in my book (see right). They all have one thing in common: a strong motivation by Darwinians to make evolution seem scientifically plausible. As we have seen, the actual facts show otherwise. And yet many of these myths continue to be foisted on the public by reporters and scientists alike.

References

[1] Bergman, Jerry. 2019. Useless Organs: The Rise and Fall of the Once Major Argument for Evolution. Tulsa, OK: Bartlett Publishing.
[2] Dartt, Darlene A. 2006. “The Conjunctiva—Structure and Function.” Chapter 2 in Duane’s Foundations of Clinical Ophthalmology.  Philadelphia, PA: Lippincott Williams & Wilkins.
[3]  Darwin, Charles. 1871. The Descent of Man, and Selection in Relation to Sex. London, England, UK: John Murray, pp. 23, 207 in Volume 1.
[4] Rogers, Kara. “7 Vestigial Features of the Human Body.” Encyclopaedia Brittanica. https://www.britannica.com/list/7-vestigial-features-of-the-human-body
[5] Lydia Ramsey and Samantha Lee, “Our DNA is 99.9% the same as the person next to us — and we’re surprisingly similar to a lot of other living things.” Business Insider, April 3, 2018.
[6]  [Could not locate cited source. An alternate suggested reference: https://www.genome.gov/15515096/2005-release-new-genome-comparison-finds-chimps-humans-very-similar-at-dna-level.]
[7] Silvertown, Jonathan (ed.). 2009. 99% Ape: How Evolution Adds Up. Chicago, IL: The University of Chicago Press.
[8] The BioLogos Forum. https://discourse.biologos.org/t/human-chimp-genome-similarity/38409.
[9] Deininger, Prescott. 2004. What does the fact that we share 95 percent of our genes with the chimpanzee mean? And how was this numbered derived?  Scientific American. March 1. https://www.scientificamerican.com/article/what-does-the-fact-that-w/
[10] Gibbins, Ann. 2012. Bonobos Join Chimps as Closest Human Relatives. Science. June 13.  https://www.sciencemag.org/news/2012/06/bonobos-join-chimps-closest-human-relatives
[11] Gunter, Chris, and Ritu Dhand. 2005. The chimpanzee genome. Nature 437: 47, September 1. https://www.nature.com/collections/srwbvyfghj.
[12] Cohen, Jon. 2007. “Relative Differences: The Myth of 1%.” Science 316:1836, June 29.
[13] Cohen, 2007, p. 1836.
[14] Cohen, 2007, p. 1836.
[15] Cohen,  2007, p. 1836. Emphasis added.
[16] Cohen,  2007, p. 1836.
[17] Bergman, Jerry. 2020. Apes as Ancestors: Examining the Claims About Human Evolution. Tulsa, OK: Bartlett Publishing. Co-Authored with Peter Line, Ph.D., and Jeffrey Tomkins, Ph.D. Chapter 5: “Are Humans and Chimps 98% Similar?” Jeffrey Tomkins, Ph.D. & Jerry Bergman, Ph.D.
[18] http://useast.ensembl.org/Homo_sapiens/Info/Annotation.


Dr. Jerry Bergman has taught biology, genetics, chemistry, biochemistry, anthropology, geology, and microbiology for over 40 years at several colleges and universities including Bowling Green State University, Medical College of Ohio where he was a research associate in experimental pathology, and The University of Toledo. He is a graduate of the Medical College of Ohio, Wayne State University in Detroit, the University of Toledo, and Bowling Green State University. He has over 1,300 publications in 12 languages and 40 books and monographs. His books and textbooks that include chapters that he authored are in over 1,500 college libraries in 27 countries. So far over 80,000 copies of the 40 books and monographs that he has authored or co-authored are in print. For more articles by Dr Bergman, see his Author Profile.

(Visited 1,174 times, 1 visits today)

Leave a Reply